5616829c5d4f default tip

RNAS
[view raw] [browse files]
author Steve Losh <steve@stevelosh.com>
date Sat, 30 Apr 2022 21:21:49 -0400
parents 1b97142d9722
children (none)
branches/tags default tip
files src/problems/motz.lisp src/problems/rnas.lisp

Changes

diff -r 1b97142d9722 -r 5616829c5d4f src/problems/motz.lisp
--- a/src/problems/motz.lisp	Sat Apr 30 21:11:44 2022 -0400
+++ b/src/problems/motz.lisp	Sat Apr 30 21:21:49 2022 -0400
@@ -6,7 +6,7 @@
 AUAU")
 
 (defparameter *output*
-  "2")
+  "7")
 
 
 ;;;; Problem ------------------------------------------------------------------
diff -r 1b97142d9722 -r 5616829c5d4f src/problems/rnas.lisp
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/src/problems/rnas.lisp	Sat Apr 30 21:21:49 2022 -0400
@@ -0,0 +1,47 @@
+(defpackage :rosalind/rnas (:use :cl :rosalind :losh :iterate))
+(in-package :rosalind/rnas)
+
+(defparameter *input*
+  "AUGCUAGUACGGAGCGAGUCUAGCGAGCGAUGUCGUGAGUACUAUAUAUGCGCAUAAGCCACGU")
+
+(defparameter *output*
+  "284850219977421")
+
+
+;;;; Problem ------------------------------------------------------------------
+(defun rna-bases-pair-p (base1 base2)
+  (member base1 (ecase base2
+                  (#\A '(#\U))
+                  (#\U '(#\A #\G))
+                  (#\G '(#\C #\U))
+                  (#\C '(#\G)))))
+
+(defun rna-matches (rna &aux (cache (make-hash-table)))
+  (recursively ((start 0)
+                (end (length rna)))
+    (if (= start end)
+      1
+      (alexandria:ensure-gethash (complex start end) cache
+        (+ (recur (1+ start) end)
+           (iterate
+             ;; This is getting tedious.
+             (with b1 = (char rna start))
+             ;; Start further away than for MOTZ.
+             (for b2 :in-string rna :from (+ start 4) :below end :with-index i)
+             (when (rna-bases-pair-p b1 b2)
+               (summing (* (recur (1+ start) i)
+                           (recur (1+ i) end))))))))))
+
+(define-problem rnas (data stream) *input* *output*
+  (rna-matches (nth-value 1 (u:read-fasta data))))
+
+
+#; Scratch --------------------------------------------------------------------
+
+
+(problem-rnas)
+
+(problem-rnas "UAGCGUGAUCAC")
+
+(time (solve rnas))
+