Expunge Clojure
| author |
Steve Losh <steve@stevelosh.com> |
| date |
Thu, 01 Nov 2018 19:46:55 -0400 |
| parents |
(none) |
| children |
(none) |
(in-package :rosalind)
;;;; Testing ------------------------------------------------------------------
(defmacro define-test (problem input output &optional (test 'string=))
`(test ,(symb 'test- problem)
(is (,test ,output (,problem ,input)))))
(defun run-tests ()
(1am:run))
;;;; Problems -----------------------------------------------------------------
(defmacro define-problem
((number name) args sample-input sample-output &body body)
(let ((symbol (symb 'problem- number)))
`(progn
(defun ,symbol ,args ,@body)
(setf (get ',symbol 'rosalind-name) ,(string-downcase name))
(define-test ,symbol ,sample-input ,sample-output)
',symbol)))
(define-problem (1 dna) (data)
"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
"20 12 17 21"
;; A string is simply an ordered collection of symbols selected from some
;; alphabet and formed into a word; the length of a string is the number of
;; symbols that it contains.
;;
;; An example of a length 21 DNA string (whose alphabet contains the symbols
;; 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."
;;
;; Given: A DNA string s of length at most 1000 nt.
;; Return: Four integers (separated by spaces) counting the respective number
;; of times that the symbols 'A', 'C', 'G', and 'T' occur in s.
(let ((results (frequencies data)))
(format nil "~D ~D ~D ~D"
(gethash #\A results)
(gethash #\C results)
(gethash #\G results)
(gethash #\T results))))
(define-problem (2 rna) (data)
"GATGGAACTTGACTACGTAAATT"
"GAUGGAACUUGACUACGUAAAUU"
;; An RNA string is a string formed from the alphabet containing 'A', 'C',
;; 'G', and 'U'.
;;
;; Given a DNA string t corresponding to a coding strand, its transcribed RNA
;; string u is formed by replacing all occurrences of 'T' in t with 'U' in u.
;;
;; Given: A DNA string t having length at most 1000 nt.
;;
;; Return: The transcribed RNA string of t.
(substitute #\U #\T data))
(define-problem (3 revc) (data)
"AAAACCCGGT"
"ACCGGGTTTT"
;; In DNA strings, symbols 'A' and 'T' are complements of each other, as are
;; 'C' and 'G'.
;;
;; The reverse complement of a DNA string s is the string sc formed by
;; reversing the symbols of s, then taking the complement of each symbol
;; (e.g., the reverse complement of "GTCA" is "TGAC").
;;
;; Given: A DNA string s of length at most 1000 bp.
;;
;; Return: The reverse complement sc of s.
(copyf data)
(flet ((dna-complement (base)
(case base
(#\A #\T)
(#\T #\A)
(#\G #\C)
(#\C #\G)
(t base)))) ; newline etc
(map-into data #'dna-complement data)
(nreverse data)))
;;;; Solutions ----------------------------------------------------------------
(defun read-problem-data (problem)
(-<> (get problem 'rosalind-name)
(format nil "~~/Downloads/rosalind_~A.txt" <>)
read-file-into-string))
(defun solve% (problem)
(pbcopy (funcall problem (read-problem-data problem))))
(defmacro solve (problem)
`(solve% ',problem))
;; (problem-3 "AAAACCCGGT")
;; (solve problem-3)