src/problems/splc.lisp @ e3aefcbf364c
Cache Uniprot results on the filesystem
This will make only the first `(run-tests)` on a given computer take forever,
instead of the first `(run-tests)` of a given Lisp session. It will also
hopefully make the Uniprot folks not hate me.
author |
Steve Losh <steve@stevelosh.com> |
date |
Fri, 24 Jan 2020 23:05:16 -0500 |
parents |
2735aa6aab79 |
children |
(none) |
(defpackage :rosalind/splc (:use :cl :rosalind :losh :iterate))
(in-package :rosalind/splc)
(defparameter *input* ">Rosalind_10
ATGGTCTACATAGCTGACAAACAGCACGTAGCAATCGGTCGAATCTCGAGAGGCATATGGTCACATGATCGGTCGAGCGTGTTTCAAAGTTTGCGCCTAG
>Rosalind_12
ATCGGTCGAA
>Rosalind_15
ATCGGTCGAGCGTGT")
(defparameter *output* "MVYIADKQHVASREAYGHMFKVCA")
(defun prefixp (prefix vector &key (start 0) (test #'eql))
(and (<= (length prefix)
(+ start (length vector)))
(iterate
(for x :in-vector prefix)
(for y :in-vector vector :from start)
(always (funcall test x y)))))
(defun string=* (string1 string2 &key (start1 0) end1 (start2 0) end2)
(let ((l1 (length string1))
(l2 (length string2)))
(string= string1 string2
:start1 (min (max 0 start1) l1)
:start2 (min (max 0 start2) l2)
:end1 (min (max 0 end1) l1)
:end2 (min (max 0 end2) l2))))
(defun intron-matches-p (intron dna &key (start 0))
(prefixp intron dna :start start))
(defun find-intron (introns dna &key (start 0))
(find-if (u:rcurry #'intron-matches-p dna :start start) introns))
(defun remove-introns (dna introns)
(iterate
(for base :in-vector dna :with-index i)
(if-let ((intron (find-intron introns dna :start i)))
(incf i (1- (length intron)))
(collect base :result-type string))))
(define-problem splc (data stream)
*input*
*output*
(destructuring-bind (dna . introns)
(mapcar #'cdr (u:read-fasta-into-alist data))
(_ dna
(remove-introns _ introns)
u:transcribe
u:translate)))