Cache Uniprot results on the filesystem
This will make only the first `(run-tests)` on a given computer take forever,
instead of the first `(run-tests)` of a given Lisp session. It will also
hopefully make the Uniprot folks not hate me.
| author |
Steve Losh <steve@stevelosh.com> |
| date |
Fri, 24 Jan 2020 23:05:16 -0500 |
| parents |
2735aa6aab79 |
| children |
(none) |
(defpackage :rosalind/rna (:use :cl :rosalind :losh :iterate))
(in-package :rosalind/rna)
;; RNA is a another nucleic acid that is similar to DNA, with the following
;; differences:
;;
;; * It uses ribose for its suger molecules (instead of deoxyribose)
;; * It contains the base Uracil (U) instead of Thymine
;; * It's single-helixed instead of double-helixed (I think?)
;;
;; RNA is produced from DNA in a multi-step process called "transcription" that
;; happens in the nucleus (at least in eukaryotes):
;;
;; 1. pre-mRNA is produced from DNA
;; 2. mRNA is produced from pre-mRNA
;;
;; After that the mRNA exists the nucleus. Then proteins are produced from the
;; mRNA by ribosomes. That process is called "translation".
(define-problem rna (data string)
"GATGGAACTTGACTACGTAAATT"
"GAUGGAACUUGACUACGUAAAUU"
"Transcribe `data` from DNA into RNA."
(u:ntranscribe data))