src/problems/prot.lisp @ e279056b1a5b
Start taking some notes
| author | Steve Losh <steve@stevelosh.com> |
|---|---|
| date | Sat, 03 Nov 2018 18:20:48 -0400 |
| parents | 8de2e6d7c9d9 |
| children | b3598dc7ef5c |
(in-package :rosalind) (defmacro codon-case ((vector index) &rest clauses) ;; Compiles a giant list of clauses into a tree of ECASEs. ;; ;; Each codon will have at most 3 ECASEs to pass through. Each ECASE has at ;; most four options, so in the worst case we end up with 3 * 4 = 12 ;; comparisons instead of 64. ;; ;; If we ever convert bases to vectors of (unsigned-byte 2)s we could ;; potentially use a lookup table here, e.g.: ;; ;; (aref +amino-acids+ (+ x (ash y 2) (ash z 4))) (alexandria:once-only (vector index) (alexandria:with-gensyms (x y z) `(let ((,x (aref ,vector ,index)) (,y (aref ,vector (+ ,index 1))) (,z (aref ,vector (+ ,index 2)))) ,(labels ((strip (clauses) (if (= 1 (length (caar clauses))) (cadar clauses) (iterate (for (head body) :in clauses) (collect (list (subseq head 1) body))))) (split (clauses) (-<> clauses (group-by (rcurry #'aref 0) <> :key #'first) (iterate (for (k v) :in-hashtable <>) (collect (list k (strip v))))))) (recursively ((clauses (split clauses)) (codons (list x y z)) (i 0)) `(ecase ,(first codons) ,@(iterate (for (k remaining) :in clauses) (collect `(,k ,(if (atom remaining) remaining (recur (split remaining) (rest codons) (1+ i))))))))))))) (defun codon-to-protein (vector index) "Return the amino acid encoded by the codon in `vector` at `index`." (codon-case (vector index) ("UUU" #\F) ("CUU" #\L) ("AUU" #\I) ("GUU" #\V) ("UUC" #\F) ("CUC" #\L) ("AUC" #\I) ("GUC" #\V) ("UUA" #\L) ("CUA" #\L) ("AUA" #\I) ("GUA" #\V) ("UUG" #\L) ("CUG" #\L) ("AUG" #\M) ("GUG" #\V) ("UCU" #\S) ("CCU" #\P) ("ACU" #\T) ("GCU" #\A) ("UCC" #\S) ("CCC" #\P) ("ACC" #\T) ("GCC" #\A) ("UCA" #\S) ("CCA" #\P) ("ACA" #\T) ("GCA" #\A) ("UCG" #\S) ("CCG" #\P) ("ACG" #\T) ("GCG" #\A) ("UAU" #\Y) ("CAU" #\H) ("AAU" #\N) ("GAU" #\D) ("UAC" #\Y) ("CAC" #\H) ("AAC" #\N) ("GAC" #\D) ("UAA" nil) ("CAA" #\Q) ("AAA" #\K) ("GAA" #\E) ("UAG" nil) ("CAG" #\Q) ("AAG" #\K) ("GAG" #\E) ("UGU" #\C) ("CGU" #\R) ("AGU" #\S) ("GGU" #\G) ("UGC" #\C) ("CGC" #\R) ("AGC" #\S) ("GGC" #\G) ("UGA" nil) ("CGA" #\R) ("AGA" #\R) ("GGA" #\G) ("UGG" #\W) ("CGG" #\R) ("AGG" #\R) ("GGG" #\G))) (defun translate (rna &key (start 0)) "Translate a string of RNA bases into a protein string of amino acids." (iterate (for i :from (search "AUG" rna :start2 start) :by 3) (for protein = (codon-to-protein rna i)) (while protein) (collect protein :result-type 'string))) (define-problem prot (data string) "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA" "MAMAPRTEINSTRING" (translate data)) ;; (solve prot)