src/problems/subs.lisp @ d6e73cb32b9b
Clean up the FASTA and buffering utils
| author | Steve Losh <steve@stevelosh.com> |
|---|---|
| date | Sat, 03 Nov 2018 12:45:52 -0400 |
| parents | bd06f66ba88f |
| children | 11df545d1a41 |
(in-package :rosalind) ;; Given two strings s and t, t is a substring of s if t is contained as ;; a contiguous collection of symbols in s (as a result, t must be no longer ;; than s). ;; ;; The position of a symbol in a string is the total number of symbols found to ;; its left, including itself (e.g., the positions of all occurrences of 'U' in ;; "AUGCUUCAGAAAGGUCUUACG" are 2, 5, 6, 15, 17, and 18). The symbol at position ;; i of s is denoted by s[i]. ;; ;; A substring of s can be represented as s[j:k], where j and k represent the ;; starting and ending positions of the substring in s; for example, if ;; s = "AUGCUUCAGAAAGGUCUUACG", then s[2:5] = "UGCU". ;; ;; The location of a substring s[j:k] is its beginning position j; note that ;; t will have multiple locations in s if it occurs more than once as ;; a substring of s (see the Sample below). ;; ;; Given: Two DNA strings s and t (each of length at most 1 kbp). ;; ;; Return: All locations of t as a substring of s. (defparameter *input-subs* "GATATATGCATATACTT ATAT") (defparameter *output-subs* "2 4 10") (define-problem subs (data stream) *input-subs* *output-subs* (let ((haystack (read-line data)) (needle (read-line data))) (iterate (for pos :seed -1 :then (search needle haystack :start2 (1+ pos))) (while pos) (collect (1+ pos) :into result) (finally (return (str:join " " result)))))) ;; (problem-subs) ;; (solve subs)