src/problems/prot.lisp @ bd06f66ba88f

(in-package :rosalind)

;; The 20 commonly occurring amino acids are abbreviated by using 20 letters
;; from the English alphabet (all letters except for B, J, O, U, X, and Z).
;; Protein strings are constructed from these 20 symbols. Henceforth, the term
;; genetic string will incorporate protein strings along with DNA strings and
;; RNA strings.
;;
;; The RNA codon table dictates the details regarding the encoding of specific
;; codons into the amino acid alphabet.
;;
;; Given: An RNA string s corresponding to a strand of mRNA (of length at most
;; 10 kbp).
;;
;; Return: The protein string encoded by s.

(define-problem prot (data string)
    "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA"
    "MAMAPRTEINSTRING"
  (translate data))

;; (solve prot)