More problems
author |
Steve Losh <steve@stevelosh.com> |
date |
Fri, 02 Nov 2018 21:08:20 -0400 |
parents |
0ea8cfbf45ce |
children |
11df545d1a41 |
(in-package :rosalind)
;; The GC-content of a DNA string is given by the percentage of symbols in
;; the string that are 'C' or 'G'. For example, the GC-content of "AGCTATAG"
;; is 37.5%. Note that the reverse complement of any DNA string has the same
;; GC-content.
;;
;; DNA strings must be labeled when they are consolidated into a database.
;; A commonly used method of string labeling is called FASTA format. In this
;; format, the string is introduced by a line that begins with '>', followed
;; by some labeling information. Subsequent lines contain the string itself;
;; the first line to begin with '>' indicates the label of the next string.
;;
;; In Rosalind's implementation, a string in FASTA format will be labeled by
;; the ID "Rosalind_xxxx", where "xxxx" denotes a four-digit code between 0000
;; and 9999.
;;
;; Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each).
;;
;; Return: The ID of the string having the highest GC-content, followed by the
;; GC-content of that string. Rosalind allows for a default error of 0.001 in
;; all decimal answers unless otherwise stated; please see the note on
;; absolute error below.
(defparameter *input-gc* ">Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>Rosalind_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>Rosalind_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT")
(defparameter *output-gc* "Rosalind_0808
60.919540")
(define-problem gc (data stream)
*input-gc*
*output-gc*
(labels ((gcp (base)
(or (char= #\G base)
(char= #\C base)))
(gc-content (string)
(/ (count-if #'gcp string)
(length string))))
(iterate
(for (label dna) :in-fasta data)
(for gc = (gc-content dna))
(finding (format nil "~A~%~,6F" label (* 100 gc))
:maximizing gc))))
;; (problem-gc *input-gc*)
;; (solve gc)