src/problems/rna.lisp @ b1baea60c24f

(in-package :rosalind)

;; RNA is a another nucleic acid that is similar to DNA, with the following
;; differences:
;;
;; * It uses ribose for its suger molecules (instead of deoxyribose)
;; * It contains the base Uracil (U) instead of Thymine
;; * It's single-helixed instead of double-helixed (I think?)
;;
;; RNA is produced from DNA in a multi-step process called "transcription" that
;; happens in the nucleus (at least in eukaryotes):
;;
;; 1. pre-mRNA is produced from DNA
;; 2. mRNA is produced from pre-mRNA
;;
;; After that the mRNA exists the nucleus.  Then proteins are produced from the
;; mRNA by ribosomes.  That process is called "translation".

(defun transcribe (dna)
  "Transcribe a fresh RNA string from `DNA`."
  (substitute #\U #\T dna))

(defun ntranscribe (dna)
  "Destructively transcribe `DNA` to RNA in-place."
  (nsubstitute #\U #\T dna))

(define-problem rna (data string)
    "GATGGAACTTGACTACGTAAATT"
    "GAUGGAACUUGACUACGUAAAUU"
  "Transcribe `data` from DNA into RNA."
  (ntranscribe data))