src/problems/tran.lisp @ 888f5c30c949
Enhance the sum/prod macros Why not?
| author | Steve Losh <steve@stevelosh.com> |
|---|---|
| date | Mon, 20 Jan 2020 14:19:26 -0500 |
| parents | 2735aa6aab79 |
| children | (none) |
(defpackage :rosalind/tran (:use :cl :rosalind :losh :iterate)) (in-package :rosalind/tran) (defparameter *input* ">Rosalind_0209 GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGA AGTACGGGCATCAACCCAGTT >Rosalind_2200 TTATCTGACAAAGAAAGCCGTCAACGGCTGGATAATTTCGCGATCGTGCTGGTTACTGGC GGTACGAGTGTTCCTTTGGGT") (defparameter *output* "1.21428571429") (defun rings (base) "Return the number of rings in the structure of `base`. Pyrimidines (cytosine, thymine, and uracil) have a single-ring structure. Purines (adenine and guanine) have a double-ring structure. " (ecase base ((#\A #\G) 2) ((#\C #\T #\U) 1))) (defun transitionp (x y) (and (char/= x y) (= (rings x) (rings y)))) (defun transversionp (x y) (and (char/= x y) (/= (rings x) (rings y)))) (define-problem tran (data stream) *input* *output* (destructuring-bind (x y) (mapcar #'cdr (u:read-fasta-into-alist data)) (format nil "~,11F" (coerce (/ (u:mapcount #'transitionp x y) (u:mapcount #'transversionp x y)) 'double-float))))