src/problems/revp.lisp @ 888f5c30c949
Enhance the sum/prod macros Why not?
| author | Steve Losh <steve@stevelosh.com> |
|---|---|
| date | Mon, 20 Jan 2020 14:19:26 -0500 |
| parents | 2735aa6aab79 |
| children | (none) |
(defpackage :rosalind/revp (:use :cl :rosalind :losh :iterate)) (in-package :rosalind/revp) ;; The problem explanation provided a clever trick: you can cut the comparison ;; size in half by comparing the first half of the string to the reverse ;; complement of the second half, instead of comparing the entire thing. ;; ;; AAC GTT ;; CAA complement ;; AAC reverse ;; AAC=AAC palindrome! (defparameter *input* ">Rosalind_24 TCAATGCATGCGGGTCTATATGCAT") (defparameter *output* "4 6 5 4 6 6 7 4 17 4 18 4 20 6 21 4 ") (defun reverse-palindrome-p (dna start length) (let ((mid (+ start (truncate length 2))) (end (+ start length))) (unless (> end (length dna)) (string= dna (u:reverse-complement (subseq dna mid end)) :start1 start :end1 mid)))) (defun reverse-palindrome-length (dna start) (iterate (for i :from 12 :downto 4 :by 2) (finding i :such-that (reverse-palindrome-p dna start i)))) (define-problem revp (data stream) *input* *output* (with-output-to-string (s) (iterate (with dna = (cdr (first (u:read-fasta-into-alist data)))) (for i :index-of-vector dna) (when-let ((l (reverse-palindrome-length dna i))) (format s "~D ~D~%" (1+ i) l)))))