src/problems/revp.lisp @ 7fd1feb477de
LEXF
author |
Steve Losh <steve@stevelosh.com> |
date |
Sat, 10 Nov 2018 16:14:15 -0500 |
parents |
23151d9021cf |
children |
2735aa6aab79 |
(in-package :rosalind)
;; The problem explanation provided a clever trick: you can cut the comparison
;; size in half by comparing the first half of the string to the reverse
;; complement of the second half, instead of comparing the entire thing.
;;
;; AAC GTT
;; CAA complement
;; AAC reverse
;; AAC=AAC palindrome!
(defparameter *input-revp*
">Rosalind_24
TCAATGCATGCGGGTCTATATGCAT")
(defparameter *output-revp*
"4 6
5 4
6 6
7 4
17 4
18 4
20 6
21 4
")
(defun reverse-palindrome-p (dna start length)
(let ((mid (+ start (truncate length 2)))
(end (+ start length)))
(unless (> end (length dna))
(string= dna
(reverse-complement (subseq dna mid end))
:start1 start
:end1 mid))))
(defun reverse-palindrome-length (dna start)
(iterate (for i :from 12 :downto 4 :by 2)
(finding i :such-that (reverse-palindrome-p dna start i))))
(define-problem revp (data stream)
*input-revp*
*output-revp*
(with-output-to-string (s)
(iterate
(with dna = (cdr (first (read-fasta-into-alist data))))
(for i :index-of-vector dna)
(when-let ((l (reverse-palindrome-length dna i)))
(format s "~D ~D~%" (1+ i) l)))))