src/problems/rna.lisp @ 6088027147e1

(in-package :rosalind)

;; An RNA string is a string formed from the alphabet containing 'A', 'C', 'G',
;; and 'U'.
;;
;; Given a DNA string t corresponding to a coding strand, its transcribed RNA
;; string u is formed by replacing all occurrences of 'T' in t with 'U' in u.
;;
;; Given: A DNA string t having length at most 1000 nt.
;;
;; Return: The transcribed RNA string of t.

(define-problem rna (data string)
    "GATGGAACTTGACTACGTAAATT"
    "GAUGGAACUUGACUACGUAAAUU"
  (substitute #\U #\T data))