src/problems/gc.lisp @ 6088027147e1

(in-package :rosalind)

;; The GC-content of a DNA string is given by the percentage of symbols in
;; the string that are 'C' or 'G'. For example, the GC-content of "AGCTATAG"
;; is 37.5%. Note that the reverse complement of any DNA string has the same
;; GC-content.
;;
;; DNA strings must be labeled when they are consolidated into a database.
;; A commonly used method of string labeling is called FASTA format. In this
;; format, the string is introduced by a line that begins with '>', followed
;; by some labeling information. Subsequent lines contain the string itself;
;; the first line to begin with '>' indicates the label of the next string.
;;
;; In Rosalind's implementation, a string in FASTA format will be labeled by
;; the ID "Rosalind_xxxx", where "xxxx" denotes a four-digit code between 0000
;; and 9999.
;;
;; Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each).
;;
;; Return: The ID of the string having the highest GC-content, followed by the
;; GC-content of that string. Rosalind allows for a default error of 0.001 in
;; all decimal answers unless otherwise stated; please see the note on
;; absolute error below.

(defparameter *input-gc* ">Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>Rosalind_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>Rosalind_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT")
(defparameter *output-gc* "Rosalind_0808
60.919540")


(define-problem gc (data stream)
    *input-gc*
    *output-gc*
  (labels ((gcp (base)
             (or (char= #\G base)
                 (char= #\C base)))
           (gc-content (string)
             (/ (count-if #'gcp string)
                (length string))))
    (iterate
      (for (label dna) :in-fasta data)
      (for gc = (gc-content dna))
      (finding (format nil "~A~%~,6F" label (* 100 gc))
               :maximizing gc))))


;; (problem-gc *input-gc*)
;; (solve problem-gc)