Refactor to remove some boilerplate
author |
Steve Losh <steve@stevelosh.com> |
date |
Sat, 23 Feb 2019 12:42:07 -0500 |
parents |
e279056b1a5b |
children |
2735aa6aab79 |
(in-package :rosalind)
;; RNA is a another nucleic acid that is similar to DNA, with the following
;; differences:
;;
;; * It uses ribose for its suger molecules (instead of deoxyribose)
;; * It contains the base Uracil (U) instead of Thymine
;; * It's single-helixed instead of double-helixed (I think?)
;;
;; RNA is produced from DNA in a multi-step process called "transcription" that
;; happens in the nucleus (at least in eukaryotes):
;;
;; 1. pre-mRNA is produced from DNA
;; 2. mRNA is produced from pre-mRNA
;;
;; After that the mRNA exists the nucleus. Then proteins are produced from the
;; mRNA by ribosomes. That process is called "translation".
(defun transcribe (dna)
"Transcribe a fresh RNA string from `DNA`."
(substitute #\U #\T dna))
(defun ntranscribe (dna)
"Destructively transcribe `DNA` to RNA in-place."
(nsubstitute #\U #\T dna))
(define-problem rna (data string)
"GATGGAACTTGACTACGTAAATT"
"GAUGGAACUUGACUACGUAAAUU"
"Transcribe `data` from DNA into RNA."
(ntranscribe data))